Review




Structured Review

Promega hd fugene transfection reagent
Hd Fugene Transfection Reagent, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fugene+hd+transfection+reagent/fugene+hd/pmc12264612-109-14-18
Average 90 stars, based on 1 article reviews
hd fugene transfection reagent - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Knock-Out:

Article Title:
Article Snippet: .. For HCT116 DROSHA knockout cells, 1–5 μg DROSHA plasmids were diluted in 500 μL of OPTI-MEM (Thermo Fisher Scientific) and mixed with 3–15 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) in 500 μL of OPTI-MEM (Thermo Fisher Scientific). .. For HEK293E DROSHA knockout cells, 0.3–1.8 μg plasmids and 0.9–5.4 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) were utilized.

Article Title:
Article Snippet: .. To rescue DROSHA expression for sequencing analysis, transfection was conducted using FuGENE HD Transfection Reagent (Promega) in HCT116 or HEK293E DROSHA knockout cells. ..

Article Title:
Article Snippet: For HCT116 DROSHA knockout cells, 1–5 μg DROSHA plasmids were diluted in 500 μL of OPTI-MEM (Thermo Fisher Scientific) and mixed with 3–15 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) in 500 μL of OPTI-MEM (Thermo Fisher Scientific). .. For HEK293E DROSHA knockout cells, 0.3–1.8 μg plasmids and 0.9–5.4 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) were utilized. ..

Transfection:

Article Title:
Article Snippet: .. For HCT116 DROSHA knockout cells, 1–5 μg DROSHA plasmids were diluted in 500 μL of OPTI-MEM (Thermo Fisher Scientific) and mixed with 3–15 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) in 500 μL of OPTI-MEM (Thermo Fisher Scientific). .. For HEK293E DROSHA knockout cells, 0.3–1.8 μg plasmids and 0.9–5.4 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) were utilized.

Article Title:
Article Snippet: .. 5 Co-transfection of DROSHA plasmids and miRNA expression vectors was performed with FuGENE HD Transfection Reagent (Promega). ..

Article Title: Supporting Information for LPS-aggregating proteins GBP1 and GBP2 are each sufficient to enhance caspase-4 activation both in cellulo and in vitro
Article Snippet: For GBP4 the sgRNA sequences were ATTGTAGGGCTATACCGCACAGG and TATCTCATGAATCGTCTTGCAGG. sgRNAs were cloned into PX459 containing Puromycin resistance ((1); pSpCas9(BB)-2APuro (PX459) was a gift from Feng Zhang (Addgene plasmid #48139) or PX458 containing an eGFP cassette ((1); pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138) following the Zhang lab, Addgene CRISPR Genome Engineering Toolbox (www.addgene.org/crispr/zhang/). .. A549 cells were transfected with PX459 or PX458 plasmids containing guide RNAs using FuGENE HD transfection reagent (Promega E2311) following manufacturers guidelines. ..

Article Title: Rab5-mediated phagocytosis restricts Spiroplasma eriocheiris infection in crabs through a ubiquitination-dependent mechanism
Article Snippet: Rab GTPases are widely expressed in eukaryotes and have been implicated in multiple intracellular transport pathways and pathogenic infection.. Spiroplasma eriocheiris, an intracellular pathogen, can cause tremor disease in Eriocheir sinensis.. However, the role of Rab GTPases in the transport mechanism during S. eriocheiris infection remains poorly understood.

Article Title: Ocular stress enhances contralateral transfer of lenadogene nolparvovec gene therapy through astrocyte networks
Article Snippet: .. Cells were transfected with FuGENE HD transfection reagent (Promega, Cat# E2311) according to the manufacturer’s protocol using 5 mg of pAAV-ND4 for 100-mm dishes, and 2 mg of pAAV-ND4 for six-well plates. ..

Article Title: Supplementary Fig. 1. Mutation analysis of the KLA patient revealed the NRAS c.182A>G, p.Q61R variant. A. Sanger trace of NGSure qPCR results demonstrating wild type allele from gDNA and heterozygous state from cfDNA. B. ddPCR result with six mutant positive droplets (right oval) from cfDNA isolated from the blood sample. Supplementary Fig. 2. Effect of trametinib on p-ERK – multiple exposure levels. HDLECs transduced with NRAS-Q61R or NRAS-WT were incubated with different doses of trametinib, Rapamycin, OSI-027 and a combination of trametinib with OSI-027. Expression of Phosphorylated ERK (p-ERK) was evaluated. A higher exposure time (lower panel) of the western blot compared to that presen
Article Snippet: .. Virus production was performed using 8 μg of total DNA (wildtype or mutant NRAS, with envelope and packaging plasmids) with 18 μL FuGENE HD Transfection Reagent (Promega; Madison, WI, USA) in HEK293T cells. ..

Article Title:
Article Snippet: .. To rescue DROSHA expression for sequencing analysis, transfection was conducted using FuGENE HD Transfection Reagent (Promega) in HCT116 or HEK293E DROSHA knockout cells. ..

Article Title:
Article Snippet: For HCT116 DROSHA knockout cells, 1–5 μg DROSHA plasmids were diluted in 500 μL of OPTI-MEM (Thermo Fisher Scientific) and mixed with 3–15 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) in 500 μL of OPTI-MEM (Thermo Fisher Scientific). .. For HEK293E DROSHA knockout cells, 0.3–1.8 μg plasmids and 0.9–5.4 μL of FuGENE HD Transfection Reagent (Promega, FuGENE HD Transfection Reagent:DNA = 3:1) were utilized. ..

Cotransfection:

Article Title:
Article Snippet: .. 5 Co-transfection of DROSHA plasmids and miRNA expression vectors was performed with FuGENE HD Transfection Reagent (Promega). ..

Expressing:

Article Title:
Article Snippet: .. 5 Co-transfection of DROSHA plasmids and miRNA expression vectors was performed with FuGENE HD Transfection Reagent (Promega). ..

Article Title:
Article Snippet: .. To rescue DROSHA expression for sequencing analysis, transfection was conducted using FuGENE HD Transfection Reagent (Promega) in HCT116 or HEK293E DROSHA knockout cells. ..

Recombinant:

Article Title: Rab5-mediated phagocytosis restricts Spiroplasma eriocheiris infection in crabs through a ubiquitination-dependent mechanism
Article Snippet: Rab GTPases are widely expressed in eukaryotes and have been implicated in multiple intracellular transport pathways and pathogenic infection.. Spiroplasma eriocheiris, an intracellular pathogen, can cause tremor disease in Eriocheir sinensis.. However, the role of Rab GTPases in the transport mechanism during S. eriocheiris infection remains poorly understood.

Virus:

Article Title: Supplementary Fig. 1. Mutation analysis of the KLA patient revealed the NRAS c.182A>G, p.Q61R variant. A. Sanger trace of NGSure qPCR results demonstrating wild type allele from gDNA and heterozygous state from cfDNA. B. ddPCR result with six mutant positive droplets (right oval) from cfDNA isolated from the blood sample. Supplementary Fig. 2. Effect of trametinib on p-ERK – multiple exposure levels. HDLECs transduced with NRAS-Q61R or NRAS-WT were incubated with different doses of trametinib, Rapamycin, OSI-027 and a combination of trametinib with OSI-027. Expression of Phosphorylated ERK (p-ERK) was evaluated. A higher exposure time (lower panel) of the western blot compared to that presen
Article Snippet: .. Virus production was performed using 8 μg of total DNA (wildtype or mutant NRAS, with envelope and packaging plasmids) with 18 μL FuGENE HD Transfection Reagent (Promega; Madison, WI, USA) in HEK293T cells. ..

Mutagenesis:

Article Title: Supplementary Fig. 1. Mutation analysis of the KLA patient revealed the NRAS c.182A>G, p.Q61R variant. A. Sanger trace of NGSure qPCR results demonstrating wild type allele from gDNA and heterozygous state from cfDNA. B. ddPCR result with six mutant positive droplets (right oval) from cfDNA isolated from the blood sample. Supplementary Fig. 2. Effect of trametinib on p-ERK – multiple exposure levels. HDLECs transduced with NRAS-Q61R or NRAS-WT were incubated with different doses of trametinib, Rapamycin, OSI-027 and a combination of trametinib with OSI-027. Expression of Phosphorylated ERK (p-ERK) was evaluated. A higher exposure time (lower panel) of the western blot compared to that presen
Article Snippet: .. Virus production was performed using 8 μg of total DNA (wildtype or mutant NRAS, with envelope and packaging plasmids) with 18 μL FuGENE HD Transfection Reagent (Promega; Madison, WI, USA) in HEK293T cells. ..

Sequencing:

Article Title:
Article Snippet: .. To rescue DROSHA expression for sequencing analysis, transfection was conducted using FuGENE HD Transfection Reagent (Promega) in HCT116 or HEK293E DROSHA knockout cells. ..



Similar Products

96
Miltenyi Biotec human miltenyi biotec 130 050 101 methoculttm stemcell h4435 fugene hd transfection reagent promega e2312 kapa rna hyperprep kit with riboerase hmr
Human Miltenyi Biotec 130 050 101 Methoculttm Stemcell H4435 Fugene Hd Transfection Reagent Promega E2312 Kapa Rna Hyperprep Kit With Riboerase Hmr, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fugene+hd+transfection+reagent/CD3+MicroBeads%2C+human/pm41512877-246-209-210
Average 96 stars, based on 1 article reviews
human miltenyi biotec 130 050 101 methoculttm stemcell h4435 fugene hd transfection reagent promega e2312 kapa rna hyperprep kit with riboerase hmr - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
New England Biolabs fugene hd transfection reagent fugene hd 1000 gibson assembly master mix new england biolabs m5510a
Fugene Hd Transfection Reagent Fugene Hd 1000 Gibson Assembly Master Mix New England Biolabs M5510a, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fugene+hd+transfection+reagent/Gibson+Assembly+Master+Mix/pm41233897-47-21-31
Average 99 stars, based on 1 article reviews
fugene hd transfection reagent fugene hd 1000 gibson assembly master mix new england biolabs m5510a - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
Valiant Co Ltd recombinant proteins fugene hd transfection reagent fugene cat
Recombinant Proteins Fugene Hd Transfection Reagent Fugene Cat, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fugene+hd+transfection+reagent/Protein+S/pm41819089-222-161-170
Average 95 stars, based on 1 article reviews
recombinant proteins fugene hd transfection reagent fugene cat - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
Promega hd fugene transfection reagent
Hd Fugene Transfection Reagent, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fugene+hd+transfection+reagent/fugene+hd/pmc12264612-109-14-18
Average 90 stars, based on 1 article reviews
hd fugene transfection reagent - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega fugene hd transfection reagent
Fugene Hd Transfection Reagent, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fugene+hd+transfection+reagent/fugene+hd/10__1016_slash_j__aquaculture__2025__742635-68-11-15
Average 90 stars, based on 1 article reviews
fugene hd transfection reagent - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results